Af1100, Af1100 (genetic_marker) Citrus spp.

Marker Overview
NameAf1100
Genbank IDCK934971
TypeCAPS
SpeciesCitrus spp.
Primer 1Af1100.Forward Primer: AACTTCCAGAGGCGTGAC
Primer 2Af1100.Reverse Primer: AGCTGATATATTGCGATTTGA
Product Length900
Restriction EnzymeNde2;Rsa1
Publication[view all]
ContactS. Ohta
Mitsuo Omura
Contact
NameDetails
S. Ohta
First name:S.
Last name:Ohta
Title:Researcher
Institution:NARO Institute of Fruit Tree Science
Address:Okitsu Citrus Research Station, NARO Institute of Fruit Tree Science, Shizuoka 424-0292, Japan
Country:Japan
Email:sohta@affrc.go.jp
Mitsuo Omura
First name:Mitsuo
Last name:Omura
Title:Researcher
Institution:NARO Institute of Fruit Tree Science
Address:Department of Citrus Research, NARO Institute of Fruit Tree Science, National Agricultural Research Organization, 485-6 Okitsu-Nakacho Shimizu-ku, Shizuoka 424-0292, Japan
Country:Japan
Email:amomura@ipc.shizuoka.ac.jp
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerAf1100.Forward PrimerCitrus spp.primer
Reverse PrimerAf1100.Reverse PrimerCitrus spp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Af1100agAf1100agCitrus spp.marker_locus
Af1100Af1100Citrus spp.marker_locus