|
Marker Overview
Name | Al0247 |
Genbank ID | C95313 |
Type | CAPS |
Species | Citrus spp. |
Primer 1 | Al0247.Forward Primer: TCTCTTTGGCCTTGATTTTAT |
Primer 2 | Al0247.Reverse Primer: GAATTGCCATCCTGTTAGTTT |
Product Length | 1400 |
Restriction Enzyme | Nde2 |
Publication | [view all] |
Contact | S. Ohta Mitsuo Omura
|
Publications
Year | Publication |
2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
2014 | Shimada T, Fujii H, Endo T, Ueda T, Sugiyama A, Nakano M, Kita M, Yoshioka T, Shimizu T, Nesumi H, Ikoma Y, Moriguchi T, Omura M. Construction of a citrus framework genetic map anchored by 708 gene-based markers. Tree genetics & genomes. 2014; 10(4):1001-1013. |
2016 | Zhang JZ, Liu SR, Hu CG. Identifying the genome-wide genetic variation between precocious trifoliate orange and its wild type and developing new markers for genetics research. DNA research : an international journal for rapid publication of reports on genes and genomes. 2016 Apr 21. |
|