|
Marker Overview
Name | Al0625 |
Genbank ID | C95496 |
Type | CAPS |
Species | Citrus spp. |
Primer 1 | Al0625.Forward Primer: AATTTCAGATGACGGCAAAG |
Primer 2 | Al0625.Reverse Primer: GCCCAAAATTCTCTACCAGAC |
Product Length | 1200 |
Restriction Enzyme | Pvu2 |
Publication | [view all] |
Contact | S. Ohta Mitsuo Omura
|
Publications
Year | Publication |
2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
2014 | Shimada T, Fujii H, Endo T, Ueda T, Sugiyama A, Nakano M, Kita M, Yoshioka T, Shimizu T, Nesumi H, Ikoma Y, Moriguchi T, Omura M. Construction of a citrus framework genetic map anchored by 708 gene-based markers. Tree genetics & genomes. 2014; 10(4):1001-1013. |
2016 | Kim C, Lee IH, Hyun HB, Kim JC, Gyawali R, Lee SG, Lee J, Kim SH, Shim BS, Cho SK, Ahn KS. Supercritical Fluid Extraction of Citrus iyo Hort. ex Tanaka Pericarp Inhibits Growth and Induces Apoptosis Through Abrogation of STAT3 Regulated Gene Products in Human Prostate Cancer Xenograft Mouse Model. Integrative cancer therapies. 2016 May 16. |
|