Bf0136, Bf0136 (genetic_marker) Citrus spp.

Marker Overview
NameBf0136
Genbank IDforward primer
TypeCAPS
SpeciesCitrus spp.
Primer 1Bf0136.Forward Primer: ACACTGACTTCTTGCCATACA
Primer 2Bf0136.Reverse Primer: ACAGAATGTGACGGGAAAC
Product Length900
Restriction EnzymeMsp1;Hha1
Publication[view all]
ContactMitsuo Omura
Contact
NameDetails
Mitsuo Omura
First name:Mitsuo
Last name:Omura
Title:Researcher
Institution:NARO Institute of Fruit Tree Science
Address:Department of Citrus Research, NARO Institute of Fruit Tree Science, National Agricultural Research Organization, 485-6 Okitsu-Nakacho Shimizu-ku, Shizuoka 424-0292, Japan
Country:Japan
Email:amomura@ipc.shizuoka.ac.jp
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerBf0136.Forward PrimerCitrus spp.primer
Reverse PrimerBf0136.Reverse PrimerCitrus spp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Bf0136afBf0136afCitrus spp.marker_locus
Bf0136Bf0136Citrus spp.marker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Citrus-Okitsu-46-gou/Kankitsu-Chukanbohon-Nou-5-gou-F2-2014AGI-07N/A45.1Bf0136afView
2Citrus-Hyuganatsu/2-11-BC1LG06N/A6Bf0136View