|
Marker Overview
Name | Bf0145 |
dbSNP ID | N/A |
Type | SNP |
SNP Alleles | N/A |
Species | Citrus spp. |
Primer 1 | Bf0145.Forward Primer: CATCTCCATCAGTCCCCACAG |
Primer 2 | Bf0145.Reverse Primer: CAACCATCAAGGCAAGAACCA |
Product Length | 1800 |
Restriction Enzyme | SI272 |
Publication | [view all] |
Contact | S. Ohta Mitsuo Omura
|
Publications
Year | Publication |
2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
2014 | Shimada T, Fujii H, Endo T, Ueda T, Sugiyama A, Nakano M, Kita M, Yoshioka T, Shimizu T, Nesumi H, Ikoma Y, Moriguchi T, Omura M. Construction of a citrus framework genetic map anchored by 708 gene-based markers. Tree genetics & genomes. 2014; 10(4):1001-1013. |
2016 | Wang J, Xiong KC, Liu YH. De novo Transcriptome Analysis of Chinese Citrus Fly, Bactrocera minax (Diptera: Tephritidae), by High-Throughput Illumina Sequencing. PloS one. 2016; 11(6):e0157656. |
|