|
Marker Overview
Name | Bf0150 |
dbSNP ID | N/A |
Type | SNP |
SNP Alleles | N/A |
Species | Citrus spp. |
Primer 1 | Bf0150.Forward Primer: AATATGGACTCGTCGGTGTT |
Primer 2 | Bf0150.Reverse Primer: GCGGAAATGTAATGATACCAA |
Product Length | 1000 |
Restriction Enzyme | SI316 |
Publication | [view all] |
Contact | S. Ohta Mitsuo Omura
|
Publications
Year | Publication |
2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
2014 | Shimada T, Fujii H, Endo T, Ueda T, Sugiyama A, Nakano M, Kita M, Yoshioka T, Shimizu T, Nesumi H, Ikoma Y, Moriguchi T, Omura M. Construction of a citrus framework genetic map anchored by 708 gene-based markers. Tree genetics & genomes. 2014; 10(4):1001-1013. |
2016 | Choi JH, Lee J, Choi IJ, Kim YW, Ryu KW, Kim J. Variations in TAS1R taste receptor gene family modify food intake and gastric cancer risk in a Korean population. Molecular nutrition & food research. 2016 Jun 20. |
|