|
Marker Overview
Name | Bf0158 |
Genbank ID | DC885888 |
Type | CAPS |
Species | Citrus spp. |
Primer 1 | Bf0158.Forward Primer: GGAATTCGAACCCAAGCCTAA |
Primer 2 | Bf0158.Reverse Primer: GCGATAACGGCGACAGTAGAG |
Product Length | 600 |
Restriction Enzyme | Pvu2 |
Publication | [view all] |
Contact | S. Ohta Mitsuo Omura
|
Publications
Year | Publication |
2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
2014 | Shimada T, Fujii H, Endo T, Ueda T, Sugiyama A, Nakano M, Kita M, Yoshioka T, Shimizu T, Nesumi H, Ikoma Y, Moriguchi T, Omura M. Construction of a citrus framework genetic map anchored by 708 gene-based markers. Tree genetics & genomes. 2014; 10(4):1001-1013. |
2016 | Shantharaj D, Römer P, Figueiredo JF, Minsavage GV, Krönauer C, Stall RE, Moore GA, Fisher LC, Hu Y, Horvath D, Lahaye T, Jones JB. An engineered promoter driving expression of a microbial avirulence gene confers recognition of TAL effectors and reduces growth of diverse Xanthomonas strains in citrus. Molecular plant pathology. 2016 Jun 30. |
|