Bf0229, Bf0229 (genetic_marker) Citrus spp.

Marker Overview
Genbank IDDC886577
SpeciesCitrus spp.
Primer 1Bf0229.Forward Primer: TACAGGCCTCATACCACTGGA
Primer 2Bf0229.Reverse Primer: CAAACGTAATCACCCCATCAA
Product Length1300
Restriction EnzymeRsa1
Publication[view all]
ContactS. Ohta
Mitsuo Omura
S. Ohta
First name:S.
Last name:Ohta
Institution:NARO Institute of Fruit Tree Science
Address:Okitsu Citrus Research Station, NARO Institute of Fruit Tree Science, Shizuoka 424-0292, Japan
Mitsuo Omura
First name:Mitsuo
Last name:Omura
Institution:NARO Institute of Fruit Tree Science
Address:Department of Citrus Research, NARO Institute of Fruit Tree Science, National Agricultural Research Organization, 485-6 Okitsu-Nakacho Shimizu-ku, Shizuoka 424-0292, Japan

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerBf0229.Forward PrimerCitrus spp.primer
Reverse PrimerBf0229.Reverse PrimerCitrus spp.primer

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Bf0229gBf0229gCitrus spp.marker_locus
Bf0229Bf0229Citrus spp.marker_locus