Cp0185, Cp0185 (genetic_marker) Citrus spp.

Marker Overview
NameCp0185
Genbank IDforward primer
TypeSTS
SpeciesCitrus spp.
Primer 1Cp0185.Forward Primer: TTATATTTGGGCCTCCTATTG
Primer 2Cp0185.Reverse Primer: CAGAGCCCGAGCGACTAGA
Product Length2600
Publication[view all]
ContactMitsuo Omura
Contact
NameDetails
Mitsuo Omura
First name:Mitsuo
Last name:Omura
Title:Researcher
Institution:NARO Institute of Fruit Tree Science
Address:Department of Citrus Research, NARO Institute of Fruit Tree Science, National Agricultural Research Organization, 485-6 Okitsu-Nakacho Shimizu-ku, Shizuoka 424-0292, Japan
Country:Japan
Email:amomura@ipc.shizuoka.ac.jp
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerCp0185.Forward PrimerCitrus spp.primer
Reverse PrimerCp0185.Reverse PrimerCitrus spp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Cp0185aCp0185aCitrus spp.marker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Citrus-Okitsu-46-gou/Kankitsu-Chukanbohon-Nou-5-gou-F2-2014AGI-03N/A51.1Cp0185aView