|
Marker Overview
Name | Cp0703 |
Genbank ID | DC891785 |
Type | CAPS |
Species | Citrus spp. |
Primer 1 | Cp0703.Forward Primer: CTCACTTGGGTCTGTTAAGGG |
Primer 2 | Cp0703.Reverse Primer: AGAAACCTTATCGGCATAC |
Product Length | 450 |
Restriction Enzyme | Rsa1 |
Publication | [view all] |
Contact | Mitsuo Omura S. Ohta
|
Publications
Year | Publication |
2014 | Shimada T, Fujii H, Endo T, Ueda T, Sugiyama A, Nakano M, Kita M, Yoshioka T, Shimizu T, Nesumi H, Ikoma Y, Moriguchi T, Omura M. Construction of a citrus framework genetic map anchored by 708 gene-based markers. Tree genetics & genomes. 2014; 10(4):1001-1013. |
2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
2016 | Zhang X, Wang W, Wang M, Zhang HY, Liu JH. The miR396b of Poncirus trifoliata Functions in Cold Tolerance by Regulating ACC Oxidase Gene Expression and Modulating Ethylene-Polyamine Homeostasis. Plant & cell physiology. 2016 Jul 11. |
|