|
|
Marker Overview
| Name | Cp0974 |
|---|
| Genbank ID | CF828226 |
|---|
| Type | CAPS |
|---|
| Species | Citrus spp. |
|---|
| Primer 1 | Cp0974.Forward Primer: GAGGGAGGAGCCGTTGCATA |
|---|
| Primer 2 | Cp0974.Reverse Primer: TCGGCAGAGGCTCTAGGTTCT |
|---|
| Product Length | 1300 |
|---|
| Restriction Enzyme | Hind3 |
|---|
| Publication | [view all] |
|---|
| Contact | Mitsuo Omura
S. Ohta
|
|---|
Publications
| Year | Publication |
|---|
| 2014 | Shimada T, Fujii H, Endo T, Ueda T, Sugiyama A, Nakano M, Kita M, Yoshioka T, Shimizu T, Nesumi H, Ikoma Y, Moriguchi T, Omura M. Construction of a citrus framework genetic map anchored by 708 gene-based markers. Tree genetics & genomes. 2014; 10(4):1001-1013. |
| 2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
| 2016 | Xia WK, Shen XM, Ding TB, Niu JZ, Zhong R, Liao CY, Feng YC, Dou W, Wang JJ. Functional analysis of a chitinase gene during the larval-nymph transition in Panonychus citri by RNA interference. Experimental & applied acarology. 2016 Jul 7. |
|
