|
Marker Overview
Name | Cp1736 |
Genbank ID | CK933122 |
Type | CAPS |
Species | Citrus spp. |
Primer 1 | Cp1736.Forward Primer: TGACTGCGATGGTGTGATTAT |
Primer 2 | Cp1736.Reverse Primer: CCGCTCCATTCCTATGA |
Product Length | 1300 |
Restriction Enzyme | Hinc2 |
Publication | [view all] |
Contact | Mitsuo Omura S. Ohta
|
Publications
Year | Publication |
2014 | Shimada T, Fujii H, Endo T, Ueda T, Sugiyama A, Nakano M, Kita M, Yoshioka T, Shimizu T, Nesumi H, Ikoma Y, Moriguchi T, Omura M. Construction of a citrus framework genetic map anchored by 708 gene-based markers. Tree genetics & genomes. 2014; 10(4):1001-1013. |
2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
2016 | Fabroni S, Ballistreri G, Amenta M, Rapisarda P. Anthocyanins in different Citrus species, an UHPLC-PDA-ESI/MS(n) -assisted qualitative and quantitative investigation. Journal of the science of food and agriculture. 2016 Jul 20. |
|