|
Marker Overview
Name | Cp2229 |
Genbank ID | DC887146 |
Type | CAPS |
Species | Citrus spp. |
Primer 1 | Cp2229.Forward Primer: CCACTCACAGTCCCGTCTT |
Primer 2 | Cp2229.Reverse Primer: ACAGACCTATTTCACGCTTGC |
Product Length | 1600 |
Restriction Enzyme | Hind3 |
Publication | [view all] |
Contact | Mitsuo Omura S. Ohta
|
Relationships
This genetic_marker is adjacent to the following primer feature(s):
Feature Name | Unique Name | Species | Type |
Forward Primer | Cp2229.Forward Primer | Citrus spp. | primer |
Reverse Primer | Cp2229.Reverse Primer | Citrus spp. | primer |
The following marker_locus feature(s) are an instance of this genetic_marker:
Publications
Year | Publication |
2014 | Shimada T, Fujii H, Endo T, Ueda T, Sugiyama A, Nakano M, Kita M, Yoshioka T, Shimizu T, Nesumi H, Ikoma Y, Moriguchi T, Omura M. Construction of a citrus framework genetic map anchored by 708 gene-based markers. Tree genetics & genomes. 2014; 10(4):1001-1013. |
2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
2000 | Nicolosi E, Deng ZN, Gentile A, La Malfa S, Continella G, Tribulato E. Citrus phylogeny and genetic origin of important species as investigated by molecular markers. Theoretical and Applied Genetics. 2000; 100(8):1155-1166. |
|