|
Marker Overview
Name | Fb0234 |
dbSNP ID | N/A |
Type | SNP |
SNP Alleles | N/A |
Species | Citrus spp. |
Primer 1 | Fb0234.Forward Primer: CCTACCATTCCCACACCT |
Primer 2 | Fb0234.Reverse Primer: TAGTTCACACCATACGCAAAA |
Product Length | 450 |
Restriction Enzyme | SI250;SI265 |
Publication | [view all] |
Contact | Mitsuo Omura S. Ohta
|
Publications
Year | Publication |
2014 | Shimada T, Fujii H, Endo T, Ueda T, Sugiyama A, Nakano M, Kita M, Yoshioka T, Shimizu T, Nesumi H, Ikoma Y, Moriguchi T, Omura M. Construction of a citrus framework genetic map anchored by 708 gene-based markers. Tree genetics & genomes. 2014; 10(4):1001-1013. |
2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
2016 | Miyahara T, Hamada A, Okamoto M, Hirose Y, Sakaguchi K, Hatano S, Ozeki Y. Identification of flavonoid 3'-hydroxylase in the yellow flower of Delphinium zalil. Journal of plant physiology. 2016 Jul 25; 202:92-96. |
|