Fb0326, Fb0326 (genetic_marker) Citrus spp.

Marker Overview
Genbank IDDC888265
SpeciesCitrus spp.
Primer 1Fb0326.Forward Primer: CCAAACTGGAGAGAACATTC
Primer 2Fb0326.Reverse Primer: ATAGACTCCTCCGCTACAGAA
Product Length1200
Restriction EnzymeMsp1
Publication[view all]
ContactMitsuo Omura
S. Ohta
Mitsuo Omura
First name:Mitsuo
Last name:Omura
Institution:NARO Institute of Fruit Tree Science
Address:Department of Citrus Research, NARO Institute of Fruit Tree Science, National Agricultural Research Organization, 485-6 Okitsu-Nakacho Shimizu-ku, Shizuoka 424-0292, Japan
S. Ohta
First name:S.
Last name:Ohta
Institution:NARO Institute of Fruit Tree Science
Address:Okitsu Citrus Research Station, NARO Institute of Fruit Tree Science, Shizuoka 424-0292, Japan

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerFb0326.Forward PrimerCitrus spp.primer
Reverse PrimerFb0326.Reverse PrimerCitrus spp.primer

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Fb0326gFb0326gCitrus spp.marker_locus
Fb0326Fb0326Citrus spp.marker_locus