|
Marker Overview
Name | Fb2156 |
Genbank ID | DC890324 |
Type | CAPS |
Species | Citrus spp. |
Primer 1 | Fb2156.Forward Primer: GTGGAATTAGTAAGGGCTCTG |
Primer 2 | Fb2156.Reverse Primer: CATCCATGCCAAAAACAA |
Product Length | 1500 |
Restriction Enzyme | Hha1 |
Publication | [view all] |
Contact | Mitsuo Omura S. Ohta
|
Publications
Year | Publication |
2014 | Shimada T, Fujii H, Endo T, Ueda T, Sugiyama A, Nakano M, Kita M, Yoshioka T, Shimizu T, Nesumi H, Ikoma Y, Moriguchi T, Omura M. Construction of a citrus framework genetic map anchored by 708 gene-based markers. Tree genetics & genomes. 2014; 10(4):1001-1013. |
2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
2016 | Fang YN, Zheng BB, Wang L, Yang W, Wu XM, Xu Q, Guo WW. High-throughput sequencing and degradome analysis reveal altered expression of miRNAs and their targets in a male-sterile cybrid pummelo (Citrus grandis). BMC genomics. 2016; 17:591. |
|