|
|
Marker Overview
| Name | Gn0068 |
|---|
| Genbank ID | AB114654 |
|---|
| Type | STS |
|---|
| Species | Citrus spp. |
|---|
| Primer 1 | Gn0068.Forward Primer: ACAAGAGTAATTAGCCGAATG |
|---|
| Primer 2 | Gn0068.Reverse Primer: AAGATGGGTGTCCGGTCATA |
|---|
| Max Length | 1200 |
|---|
| Publication | [view all] |
|---|
| Contact | Mitsuo Omura
S. Ohta
|
|---|
Publications
| Year | Publication |
|---|
| 2014 | Shimada T, Fujii H, Endo T, Ueda T, Sugiyama A, Nakano M, Kita M, Yoshioka T, Shimizu T, Nesumi H, Ikoma Y, Moriguchi T, Omura M. Construction of a citrus framework genetic map anchored by 708 gene-based markers. Tree genetics & genomes. 2014; 10(4):1001-1013. |
| 2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
| 2016 | Liu X, Guo LX, Jin LF, Liu YZ, Liu T, Fan YH, Peng SA. Identification and transcript profiles of citrus growth-regulating factor genes involved in the regulation of leaf and fruit development. Molecular biology reports. 2016 Aug 4. |
|
