If0216, If0216 (genetic_marker) Citrus spp.

Marker Overview
Genbank IDDC893436
SpeciesCitrus spp.
Primer 1If0216.Forward Primer: CTCAGTCCCCATCTTCAGTTC
Primer 2If0216.Reverse Primer: CAATTCCCAAACCAGCACTT
Product Length1600
Restriction EnzymeSty1
Publication[view all]
ContactMitsuo Omura
S. Ohta
Mitsuo Omura
First name:Mitsuo
Last name:Omura
Institution:NARO Institute of Fruit Tree Science
Address:Department of Citrus Research, NARO Institute of Fruit Tree Science, National Agricultural Research Organization, 485-6 Okitsu-Nakacho Shimizu-ku, Shizuoka 424-0292, Japan
S. Ohta
First name:S.
Last name:Ohta
Institution:NARO Institute of Fruit Tree Science
Address:Okitsu Citrus Research Station, NARO Institute of Fruit Tree Science, Shizuoka 424-0292, Japan

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerIf0216.Forward PrimerCitrus spp.primer
Reverse PrimerIf0216.Reverse PrimerCitrus spp.primer

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
If0216gIf0216gCitrus spp.marker_locus
If0216If0216Citrus spp.marker_locus