Lp0207, Lp0207 (genetic_marker) Citrus spp.

Marker Overview
NameLp0207
Genbank IDDC893272
TypeCAPS
SpeciesCitrus spp.
Primer 1Lp0207.Forward Primer: GTGACAAACTTGGGGTGAA
Primer 2Lp0207.Reverse Primer: CAAAATCATGGATACCGAAAT
Product Length1500
Restriction EnzymeMsp1;Hind3
Publication[view all]
ContactMitsuo Omura
S. Ohta
Contact
NameDetails
Mitsuo Omura
First name:Mitsuo
Last name:Omura
Title:Researcher
Institution:NARO Institute of Fruit Tree Science
Address:Department of Citrus Research, NARO Institute of Fruit Tree Science, National Agricultural Research Organization, 485-6 Okitsu-Nakacho Shimizu-ku, Shizuoka 424-0292, Japan
Country:Japan
Email:amomura@ipc.shizuoka.ac.jp
S. Ohta
First name:S.
Last name:Ohta
Title:Researcher
Institution:NARO Institute of Fruit Tree Science
Address:Okitsu Citrus Research Station, NARO Institute of Fruit Tree Science, Shizuoka 424-0292, Japan
Country:Japan
Email:sohta@affrc.go.jp
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerLp0207.Forward PrimerCitrus spp.primer
Reverse PrimerLp0207.Reverse PrimerCitrus spp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Lp0207afLp0207afCitrus spp.marker_locus
Lp0207Lp0207Citrus spp.marker_locus