|
Marker Overview
Name | Lp0226 |
Genbank ID | AU300802 |
Type | CAPS |
Species | Citrus spp. |
Primer 1 | Lp0226.Forward Primer: CCAACGCAAGGAAGATAGA |
Primer 2 | Lp0226.Reverse Primer: CTCAACAGTTAAACCCAAAAA |
Product Length | 2000 |
Restriction Enzyme | Pvu2 |
Publication | [view all] |
Contact | Mitsuo Omura S. Ohta
|
Publications
Year | Publication |
2014 | Shimada T, Fujii H, Endo T, Ueda T, Sugiyama A, Nakano M, Kita M, Yoshioka T, Shimizu T, Nesumi H, Ikoma Y, Moriguchi T, Omura M. Construction of a citrus framework genetic map anchored by 708 gene-based markers. Tree genetics & genomes. 2014; 10(4):1001-1013. |
2016 | Shang F, Ding BY, Xiong Y, Dou W, Wei D, Jiang HB, Wei DD, Wang JJ. Differential expression of genes in the alate and apterous morphs of the brown citrus aphid, Toxoptera citricida. Scientific reports. 2016; 6:32099. |
|