Mf0039, Mf0039 (genetic_marker) Citrus spp.

Marker Overview
NameMf0039
dbSNP IDN/A
TypeSNP
SNP AllelesN/A
SpeciesCitrus spp.
Primer 1Mf0039.Forward Primer: CCAATTCCTCAATATATGCAG
Primer 2Mf0039.Reverse Primer: CACAAGTATACTGCTGTACCA
Product Length1500
Restriction EnzymeSI016
Publication[view all]
ContactMitsuo Omura
Contact
NameDetails
Mitsuo Omura
First name:Mitsuo
Last name:Omura
Title:Researcher
Institution:NARO Institute of Fruit Tree Science
Address:Department of Citrus Research, NARO Institute of Fruit Tree Science, National Agricultural Research Organization, 485-6 Okitsu-Nakacho Shimizu-ku, Shizuoka 424-0292, Japan
Country:Japan
Email:amomura@ipc.shizuoka.ac.jp
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerMf0039.Forward PrimerCitrus spp.primer
Reverse PrimerMf0039.Reverse PrimerCitrus spp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Mf0039fMf0039fCitrus spp.marker_locus
Mf0039Mf0039Citrus spp.marker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Citrus-Okitsu-46-gou/Kankitsu-Chukanbohon-Nou-5-gou-F2-2014AGI-05N/A5.5Mf0039fView
2Citrus-Hyuganatsu/2-11-BC1LG03N/A85.2Mf0039View