|
Marker Overview
Name | Mf0090 |
Genbank ID | C81890 |
Type | CAPS |
Species | Citrus spp. |
Primer 1 | Mf0090.Forward Primer: CTCACTGATGCATTGATGAAG |
Primer 2 | Mf0090.Reverse Primer: TTCCTTTTGAGAGGGGGAGAA |
Product Length | 1000 |
Restriction Enzyme | Dra;Msp1 |
Publication | [view all] |
Contact | Mitsuo Omura S. Ohta
|
Publications
Year | Publication |
2014 | Shimada T, Fujii H, Endo T, Ueda T, Sugiyama A, Nakano M, Kita M, Yoshioka T, Shimizu T, Nesumi H, Ikoma Y, Moriguchi T, Omura M. Construction of a citrus framework genetic map anchored by 708 gene-based markers. Tree genetics & genomes. 2014; 10(4):1001-1013. |
2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
2016 | Long JM, Liu Z, Wu XM, Fang YN, Jia HH, Xie ZZ, Deng XX, Guo WW. Genome-scale mRNA and small RNA transcriptomic insights into initiation of citrus apomixis. Journal of experimental botany. 2016 Sep 12. |
|