Ov0015, Ov0015 (genetic_marker) Citrus spp.

Marker Overview
NameOv0015
dbSNP IDN/A
TypeSNP
SNP AllelesN/A
SpeciesCitrus spp.
Primer 1Ov0015.Forward Primer: CACTGCCATTATTCTTCTT
Primer 2Ov0015.Reverse Primer: TATTCAAAATCCCAAGTAAAC
Product Length1150
Restriction EnzymeSI304
Publication[view all]
ContactMitsuo Omura
Contact
NameDetails
Mitsuo Omura
First name:Mitsuo
Last name:Omura
Title:Researcher
Institution:NARO Institute of Fruit Tree Science
Address:Department of Citrus Research, NARO Institute of Fruit Tree Science, National Agricultural Research Organization, 485-6 Okitsu-Nakacho Shimizu-ku, Shizuoka 424-0292, Japan
Country:Japan
Email:amomura@ipc.shizuoka.ac.jp
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerOv0015.Forward PrimerCitrus spp.primer
Reverse PrimerOv0015.Reverse PrimerCitrus spp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Ov0015aOv0015aCitrus spp.marker_locus
Ov0015Ov0015Citrus spp.marker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Citrus-Okitsu-46-gou/Kankitsu-Chukanbohon-Nou-5-gou-F2-2014AGI-02N/A34.5Ov0015aView
2Citrus-Hyuganatsu/2-11-BC1LG02N/A51.7Ov0015View