Ov0117, Ov0117 (genetic_marker) Citrus spp.

Marker Overview
NameOv0117
dbSNP IDN/A
TypeSNP
SNP AllelesN/A
SpeciesCitrus spp.
Primer 1Ov0117.Taqman F Primer: GGCTCAAAATCCGGATAAGGGAATA
Primer 2Ov0117.Taqman R primer: AATTTGCACATTCTGGCTATGAAGTG
Primer 3Ov0117.Taqman probe FAM: TCAACATCAAAGCATCTT
Primer 4Ov0117.Taqman probe VIC: CAACATCAAGGCATCTT
Publication[view all]
ContactMitsuo Omura
S. Ohta
Contact
NameDetails
Mitsuo Omura
First name:Mitsuo
Last name:Omura
Title:Researcher
Institution:NARO Institute of Fruit Tree Science
Address:Department of Citrus Research, NARO Institute of Fruit Tree Science, National Agricultural Research Organization, 485-6 Okitsu-Nakacho Shimizu-ku, Shizuoka 424-0292, Japan
Country:Japan
Email:amomura@ipc.shizuoka.ac.jp
S. Ohta
First name:S.
Last name:Ohta
Title:Researcher
Institution:NARO Institute of Fruit Tree Science
Address:Okitsu Citrus Research Station, NARO Institute of Fruit Tree Science, Shizuoka 424-0292, Japan
Country:Japan
Email:sohta@affrc.go.jp
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Taqman F PrimerOv0117.Taqman F PrimerCitrus spp.primer
Taqman R primerOv0117.Taqman R primerCitrus spp.primer
Taqman probe VICOv0117.Taqman probe VICCitrus spp.primer
Taqman probe FAMOv0117.Taqman probe FAMCitrus spp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Ov0117gOv0117gCitrus spp.marker_locus
Ov0117Ov0117Citrus spp.marker_locus