Ov0305, Ov0305 (genetic_marker) Citrus spp.

Marker Overview
NameOv0305
Genbank IDAU186464
TypeCAPS
SpeciesCitrus spp.
Primer 1Ov0305.Forward Primer: CATCTGGTCCCCACAAGT
Primer 2Ov0305.Reverse Primer: AGCTTTAGAGAGTGCCAATCA
Product Length1250
Restriction EnzymeMsp1
Publication[view all]
ContactMitsuo Omura
S. Ohta
Contact
NameDetails
Mitsuo Omura
First name:Mitsuo
Last name:Omura
Title:Researcher
Institution:NARO Institute of Fruit Tree Science
Address:Department of Citrus Research, NARO Institute of Fruit Tree Science, National Agricultural Research Organization, 485-6 Okitsu-Nakacho Shimizu-ku, Shizuoka 424-0292, Japan
Country:Japan
Email:amomura@ipc.shizuoka.ac.jp
S. Ohta
First name:S.
Last name:Ohta
Title:Researcher
Institution:NARO Institute of Fruit Tree Science
Address:Okitsu Citrus Research Station, NARO Institute of Fruit Tree Science, Shizuoka 424-0292, Japan
Country:Japan
Email:sohta@affrc.go.jp
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerOv0305.Forward PrimerCitrus spp.primer
Reverse PrimerOv0305.Reverse PrimerCitrus spp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Ov0305fOv0305fCitrus spp.marker_locus
Ov0305Ov0305Citrus spp.marker_locus