|
|
Marker Overview
| Name | Ov0407 |
|---|
| Genbank ID | AU186524 |
|---|
| Type | CAPS |
|---|
| Species | Citrus spp. |
|---|
| Primer 1 | Ov0407.Forward Primer: CCCATGAATCGTTGCCTG |
|---|
| Primer 2 | Ov0407.Reverse Primer: AGGGGACCATCCAAGGTAAAA |
|---|
| Product Length | 2200 |
|---|
| Restriction Enzyme | Msp1 |
|---|
| Publication | [view all] |
|---|
| Contact | Mitsuo Omura
S. Ohta
|
|---|
Publications
| Year | Publication |
|---|
| 2014 | Shimada T, Fujii H, Endo T, Ueda T, Sugiyama A, Nakano M, Kita M, Yoshioka T, Shimizu T, Nesumi H, Ikoma Y, Moriguchi T, Omura M. Construction of a citrus framework genetic map anchored by 708 gene-based markers. Tree genetics & genomes. 2014; 10(4):1001-1013. |
| 2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
| 2016 | Wang W, Wang M, Wang J, Zhu C, Chung KR, Li H. Adenylyl cyclase is required for cAMP production, growth, conidial germination, and virulence in the citrus green mold pathogen Penicillium digitatum. Microbiological research. 2016 Nov; 192:11-20. |
|
