Ov0509, Ov0509 (genetic_marker) Citrus spp.

Marker Overview
Genbank IDDC894046
SpeciesCitrus spp.
Primer 1Ov0509.Forward Primer: CGGGGCCATAATAATG
Primer 2Ov0509.Reverse Primer: AATAGTACCTACCAGCCAAAA
Product Length750
Restriction EnzymeSty1
Publication[view all]
ContactMitsuo Omura
S. Ohta
Mitsuo Omura
First name:Mitsuo
Last name:Omura
Institution:NARO Institute of Fruit Tree Science
Address:Department of Citrus Research, NARO Institute of Fruit Tree Science, National Agricultural Research Organization, 485-6 Okitsu-Nakacho Shimizu-ku, Shizuoka 424-0292, Japan
S. Ohta
First name:S.
Last name:Ohta
Institution:NARO Institute of Fruit Tree Science
Address:Okitsu Citrus Research Station, NARO Institute of Fruit Tree Science, Shizuoka 424-0292, Japan

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerOv0509.Forward PrimerCitrus spp.primer
Reverse PrimerOv0509.Reverse PrimerCitrus spp.primer

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Ov0509gOv0509gCitrus spp.marker_locus
Ov0509Ov0509Citrus spp.marker_locus