|
|
Marker Overview
| Name | Ov0525 |
|---|
| Genbank ID | AU186243 |
|---|
| Type | CAPS |
|---|
| Species | Citrus spp. |
|---|
| Primer 1 | Ov0525.Forward Primer: CATACTTCATTTCTGGGGTCT |
|---|
| Primer 2 | Ov0525.Reverse Primer: AAGTATTAACCGCCACCAC |
|---|
| Product Length | 1600 |
|---|
| Restriction Enzyme | Msp1 |
|---|
| Publication | [view all] |
|---|
| Contact | Mitsuo Omura
S. Ohta
|
|---|
Publications
| Year | Publication |
|---|
| 2014 | Shimada T, Fujii H, Endo T, Ueda T, Sugiyama A, Nakano M, Kita M, Yoshioka T, Shimizu T, Nesumi H, Ikoma Y, Moriguchi T, Omura M. Construction of a citrus framework genetic map anchored by 708 gene-based markers. Tree genetics & genomes. 2014; 10(4):1001-1013. |
| 2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
| 2017 | Ballester AR, Lafuente MT. LED Blue Light-induced changes in phenolics and ethylene in citrus fruit: Implication in elicited resistance against Penicillium digitatum infection. Food chemistry. 2017 Mar 1; 218:575-583. |
|
