Tf0150, Tf0150 (genetic_marker) Citrus spp. | Citrus Genome Database

Marker Overview

Marker Overview


Name	Tf0150
Genbank ID	forward primer
Type	CAPS
Species	Citrus spp.
Primer 1	Tf0150.Forward Primer: ACAGAAGAGGCCACAATCT
Primer 2	Tf0150.Reverse Primer: TTTCTTCAGCTAAAGCGTCAC
Product Length	500
Restriction Enzyme	Hinf1
Publication	[view all]
Contact	Mitsuo Omura S. Ohta

Contact

Name

Details

Mitsuo Omura

First name:	Mitsuo
Last name:	Omura
Title:	Researcher
Institution:	NARO Institute of Fruit Tree Science
Address:	Department of Citrus Research, NARO Institute of Fruit Tree Science, National Agricultural Research Organization, 485-6 Okitsu-Nakacho Shimizu-ku, Shizuoka 424-0292, Japan
Country:	Japan
Email:	amomura@ipc.shizuoka.ac.jp

S. Ohta

First name:	S.
Last name:	Ohta
Title:	Researcher
Institution:	NARO Institute of Fruit Tree Science
Address:	Okitsu Citrus Research Station, NARO Institute of Fruit Tree Science, Shizuoka 424-0292, Japan
Country:	Japan
Email:	sohta@affrc.go.jp

Publications


Year	Publication
2014	Shimada T, Fujii H, Endo T, Ueda T, Sugiyama A, Nakano M, Kita M, Yoshioka T, Shimizu T, Nesumi H, Ikoma Y, Moriguchi T, Omura M. Construction of a citrus framework genetic map anchored by 708 gene-based markers. Tree genetics & genomes. 2014; 10(4):1001-1013.
2015	Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Citrus-Okitsu-46-gou/Kankitsu-Chukanbohon-Nou-5-gou-F2-2014	AGI-08	N/A	25.2	Tf0150a	View