|
Marker Overview
Name | Tf0307 |
Genbank ID | CK934986 |
Type | CAPS |
Species | Citrus spp. |
Primer 1 | Tf0307.Forward Primer: ATGCGGGAAGAGTTGTAGGCT |
Primer 2 | Tf0307.Reverse Primer: TCATGGCCGAAATCGTCAAGA |
Product Length | 950 |
Restriction Enzyme | Msp1 |
Publication | [view all] |
Contact | Mitsuo Omura S. Ohta
|
Publications
Year | Publication |
2014 | Shimada T, Fujii H, Endo T, Ueda T, Sugiyama A, Nakano M, Kita M, Yoshioka T, Shimizu T, Nesumi H, Ikoma Y, Moriguchi T, Omura M. Construction of a citrus framework genetic map anchored by 708 gene-based markers. Tree genetics & genomes. 2014; 10(4):1001-1013. |
2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
2016 | Mishra AK, Duraisamy GS, Matoušek J, Radisek S, Javornik B, Jakse J. Identification and characterization of microRNAs in Humulus lupulus using high-throughput sequencing and their response to Citrus bark cracking viroid (CBCVd) infection. BMC genomics. 2016 Nov 15; 17(1):919. |
|