|
Marker Overview
Name | Af1011 |
Genbank ID | CX047249 |
Type | genetic marker |
Species | Citrus spp. |
Primer 1 | Af1011.Forward Primer: ATTCATTACCTCCCAACTCAA |
Primer 2 | Af1011.Reverse Primer: ATAACAAAGCGCAGTG |
Restriction Enzyme | HincII |
Publication | [view all] |
Contact | S. Ohta
|
Publications
Year | Publication |
2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
2016 | Gandolfo DS, Mortimer H, Woodhall JW, Boonham N. Fourier transform infra-red spectroscopy using an attenuated total reflection probe to distinguish between Japanese larch, pine and citrus plants in healthy and diseased states. Spectrochimica acta. Part A, Molecular and biomolecular spectroscopy. 2016 Mar 25; 163:181-188. |
|