|
Marker Overview
Name | Af1026 |
Genbank ID | CK939862 |
Type | genetic marker |
Species | Citrus spp. |
Primer 1 | Af1026.Forward Primer: TTAGTGACTGCCATCGCTGAC |
Primer 2 | Af1026.Reverse Primer: ATGTGGATGTTTCGCAATTTA |
Restriction Enzyme | HaeIII |
Publication | [view all] |
Contact | S. Ohta
|
Publications
Year | Publication |
2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
2016 | Louzada ES, Vazquez OE, Braswell WE, Yanev G, Devanaboina M, Kunta M. Distribution of Candidatus Liberibacter asiaticus above and below Ground in Texas Citrus. Phytopathology. 2016 Apr 6. |
|