|
Marker Overview
Name | Af1485 |
Genbank ID | CX070889 |
Type | genetic marker |
Species | Citrus spp. |
Primer 1 | Af1485.Forward Primer: CGGCATAGGGATACACTT |
Primer 2 | Af1485.Reverse Primer: GATTGGAATGTTCTCGCAGTT |
Restriction Enzyme | HaeIII |
Publication | [view all] |
Contact | S. Ohta
|
Publications
Year | Publication |
2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
2016 | Ikoma Y, Matsumoto H, Kato M. Diversity in the carotenoid profiles and the expression of genes related to carotenoid accumulation among citrus genotypes. Breeding science. 2016 Jan; 66(1):139-47. |
|