|
Marker Overview
Name | Al0212 |
Genbank ID | C95259 |
Type | genetic marker |
Species | Citrus spp. |
Primer 1 | Al0212.Forward Primer: TAGCTTTTGGCCTTCATTCTC |
Primer 2 | Al0212.Reverse Primer: ATTTTGATCGTCGTTGTCGT |
Restriction Enzyme | MspI |
Publication | [view all] |
Contact | S. Ohta
|
Publications
Year | Publication |
2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
2016 | Atanasov KE, Barboza-Barquero L, Tiburcio AF, Alcázar R. Genome Wide Association Mapping for the Tolerance to the Polyamine Oxidase Inhibitor Guazatine in Arabidopsis thaliana. Frontiers in plant science. 2016; 7:401. |
|