|
|
Marker Overview
| Name | Al0234 |
|---|
| Genbank ID | C95291 |
|---|
| Type | genetic marker |
|---|
| Species | Citrus spp. |
|---|
| Primer 1 | Al0234.Forward Primer: AAGTTACAGAAGCGGCTCTC |
|---|
| Primer 2 | Al0234.Reverse Primer: TTTGCCATTAAACAGAAAACA |
|---|
| Restriction Enzyme | MspI |
|---|
| Publication | [view all] |
|---|
| Contact | S. Ohta
|
|---|
Publications
| Year | Publication |
|---|
| 2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
| 2016 | Biasi A, Martin FN, Cacciola SO, Magnano di San Lio G, Grunwald N, Schena L. Genetic Analysis of Phytophthora nicotianae Populations From Different Hosts Using Microsatellite Markers. Phytopathology. 2016 Apr 25. |
|
