|
Marker Overview
Name | Al0505 |
Genbank ID | C95445 |
Type | genetic marker |
Species | Citrus spp. |
Primer 1 | Al0505.Forward Primer: GTTAGACTGGGAGCCAACAAG |
Primer 2 | Al0505.Reverse Primer: ACAGCGCCCACCTACTTAG |
Restriction Enzyme | HaeIII |
Publication | [view all] |
Contact | S. Ohta
|
Publications
Year | Publication |
2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
2016 | Shen SL, Yin XR, Zhang B, Xie XL, Jiang Q, Grierson D, Chen KS. CitAP2.10 activation of the terpene synthase CsTPS1 is associated with the synthesis of (+)-valencene in 'Newhall' orange. Journal of experimental botany. 2016 May 18. |
|