|
Marker Overview
Name | Al0630 |
Genbank ID | C95509 |
Type | genetic marker |
Species | Citrus spp. |
Primer 1 | Al0630.Forward Primer: ACAGCGCCCAATCAGA |
Primer 2 | Al0630.Reverse Primer: GCAGGCAAACACTTTATGAAG |
Restriction Enzyme | DraI |
Publication | [view all] |
Contact | S. Ohta
|
Publications
Year | Publication |
2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
2016 | Sundin GW, Wang N, Charkowski AO, Castiblanco LF, Jia H, Zhao Y. Perspectives on the transition from bacterial phytopathogen genomics studies to applications enhancing disease management: from promise to practice. Phytopathology. 2016 May 16. |
|