|
Marker Overview
Name | Al0633 |
Genbank ID | C95520 |
Type | genetic marker |
Species | Citrus spp. |
Primer 1 | Al0633.Forward Primer: CCAGGGCACAAGGAAAAGAT |
Primer 2 | Al0633.Reverse Primer: GGTCATACCCCCATCAACAAA |
Restriction Enzyme | MspI |
Publication | [view all] |
Contact | S. Ohta
|
Publications
Year | Publication |
2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
2016 | Chang X, Wang S, Bao YR, Li TJ, Yu XM, Meng XS. Multicomponent,multitarget integrated adjustment- metabolomics study of Qizhiweitong particles curing gastrointestinal motility disorders in mice induced by atropine. Journal of ethnopharmacology. 2016 May 11. |
|