|
Marker Overview
Name | Al0637 |
Genbank ID | C95541 |
Type | genetic marker |
Species | Citrus spp. |
Primer 1 | Al0637.Forward Primer: CACTCTTGCCAACGGGTAT |
Primer 2 | Al0637.Reverse Primer: GAGCTAATTGAAATCGCAGAA |
Restriction Enzyme | RsaI |
Publication | [view all] |
Contact | S. Ohta
|
Publications
Year | Publication |
2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
2016 | Fu S, Shao J, Zhou C, Hartung JS. Transcriptome analysis of sweet orange trees infected with 'Candidatus Liberibacter asiaticus' and two strains of Citrus Tristeza Virus. BMC genomics. 2016; 17(1):349. |
|