|
|
Marker Overview
| Name | Bf0003 |
|---|
| Genbank ID | DC884981 |
|---|
| Type | genetic marker |
|---|
| Species | Citrus spp. |
|---|
| Primer 1 | Bf0003.Forward Primer: TGCCACAGCCTTCACTCTA |
|---|
| Primer 2 | Bf0003.Reverse Primer: GAGCCGAGAAATACCATCACT |
|---|
| Restriction Enzyme | NdeII |
|---|
| Publication | [view all] |
|---|
| Contact | S. Ohta
|
|---|
Relationships
This genetic_marker is adjacent to the following primer feature(s):
| Feature Name | Unique Name | Species | Type |
|---|
| Forward Primer | Bf0003.Forward Primer | Citrus spp. | primer |
| Reverse Primer | Bf0003.Reverse Primer | Citrus spp. | primer |
The following marker_locus feature(s) are an instance of this genetic_marker:
| Feature Name | Unique Name | Species | Type |
|---|
| Bf0003 | Bf0003 | Citrus spp. | marker_locus |
Publications
| Year | Publication |
|---|
| 2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
| 2016 | Wagschal K, Rose Stoller J, Chan VJ, Lee CC, Grigorescu AA, Jordan DB. Expression and Characterization of Hyperthermostable Exo-polygalacturonase TtGH28 from Thermotoga thermophilus. Molecular biotechnology. 2016 May 21. |
|
