Bf0003, Bf0003 (genetic_marker) Citrus spp.

Marker Overview
NameBf0003
Genbank IDDC884981
Typegenetic marker
SpeciesCitrus spp.
Primer 1Bf0003.Forward Primer: TGCCACAGCCTTCACTCTA
Primer 2Bf0003.Reverse Primer: GAGCCGAGAAATACCATCACT
Restriction EnzymeNdeII
Publication[view all]
ContactS. Ohta
Contact
NameDetails
S. Ohta
First name:S.
Last name:Ohta
Title:Researcher
Institution:NARO Institute of Fruit Tree Science
Address:Okitsu Citrus Research Station, NARO Institute of Fruit Tree Science, Shizuoka 424-0292, Japan
Country:Japan
Email:sohta@affrc.go.jp
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerBf0003.Forward PrimerCitrus spp.primer
Reverse PrimerBf0003.Reverse PrimerCitrus spp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Bf0003Bf0003Citrus spp.marker_locus