|
Marker Overview
Name | Bf0016 |
Genbank ID | DC885073 |
Type | genetic marker |
Species | Citrus spp. |
Primer 1 | Bf0016.Forward Primer: CCTTCTCTCCCGTTCTT |
Primer 2 | Bf0016.Reverse Primer: AAACTAAGGGCATACATCATC |
Restriction Enzyme | EcoRI |
Publication | [view all] |
Contact | S. Ohta
|
Publications
Year | Publication |
2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
2016 | Sridharan B, Mehra Y, Ganesh RN, Pragasam V. Regulation of urinary crystal inhibiting proteins and inflammatory genes by lemon peel extract and formulated citrus bioflavonoids on ethylene glycol induced urolithic rats. Food and chemical toxicology : an international journal published for the British Industrial Biological Research Association. 2016 May 27. |
|