Bf0019, Bf0019 (genetic_marker) Citrus spp.

Marker Overview
NameBf0019
Genbank IDDC885098
Typegenetic marker
SpeciesCitrus spp.
Primer 1Bf0019.Forward Primer: CTTCAAAGGTTGGCTGGAT
Primer 2Bf0019.Reverse Primer: AGTCATCTTACTCGGGGTGAG
Restriction EnzymeNC
Publication[view all]
ContactS. Ohta
Contact
NameDetails
S. Ohta
First name:S.
Last name:Ohta
Title:Researcher
Institution:NARO Institute of Fruit Tree Science
Address:Okitsu Citrus Research Station, NARO Institute of Fruit Tree Science, Shizuoka 424-0292, Japan
Country:Japan
Email:sohta@affrc.go.jp
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerBf0019.Forward PrimerCitrus spp.primer
Reverse PrimerBf0019.Reverse PrimerCitrus spp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Bf0019Bf0019Citrus spp.marker_locus