|
Marker Overview
Name | Bf0125 |
Genbank ID | DC885619 |
Type | genetic marker |
Species | Citrus spp. |
Primer 1 | Bf0125.Forward Primer: CGAGCGAGCGAGCAAGC |
Primer 2 | Bf0125.Reverse Primer: TTGGTTCCGATCCTCCTCCAG |
Restriction Enzyme | NC |
Publication | [view all] |
Contact | S. Ohta
|
Publications
Year | Publication |
2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
2016 | Shiu YL, Lin HL, Chi CC, Yeh SP, Liu CH. Effects of hirami lemon, Citrus depressa Hayata, leaf meal in diets on the immune response and disease resistance of juvenile barramundi, Lates calcarifer (bloch), against Aeromonas hydrophila. Fish & shellfish immunology. 2016 Jun 2. |
|