Bf0193, Bf0193 (genetic_marker) Citrus spp.

Marker Overview
Genbank IDDC886216
Typegenetic marker
SpeciesCitrus spp.
Primer 1Bf0193.Forward Primer: TACATGTTGGAAGGGCTTAG
Primer 2Bf0193.Reverse Primer: CTCAATCGATATGGGGTAAAT
Restriction EnzymeBamHI
Publication[view all]
ContactS. Ohta
S. Ohta
First name:S.
Last name:Ohta
Institution:NARO Institute of Fruit Tree Science
Address:Okitsu Citrus Research Station, NARO Institute of Fruit Tree Science, Shizuoka 424-0292, Japan

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerBf0193.Forward PrimerCitrus spp.primer
Reverse PrimerBf0193.Reverse PrimerCitrus spp.primer

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Bf0193Bf0193Citrus spp.marker_locus