|
Marker Overview
Name | Bf0202 |
Genbank ID | DC886321 |
Type | genetic marker |
Species | Citrus spp. |
Primer 1 | Bf0202.Forward Primer: GGTGACTACCGCCTTGGATTT |
Primer 2 | Bf0202.Reverse Primer: CAGGGATACGTCGCTGGATT |
Restriction Enzyme | StyI |
Publication | [view all] |
Contact | S. Ohta
|
Publications
Year | Publication |
2015 | Ohta S, Endo T, Shimada T, Fujii H, Shimizu T, Kita M, Kuniga T, Yoshioka T, Nesumi H, Yoshida T, Omura M. Construction of genetic linkage map and graphical genotyping of pseudo-backcrossed F2 (BC’ 2) progeny to introduce a CTV resistance from Poncirus trifoliata (L.) Raf. into Citrus by introgression breeding. Tree genetics & genomes. 2015; 11(1):797. |
2016 | Guo LX, Shi CY, Liu X, Ning DY, Jing LF, Yang H, Liu YZ. Citrate Accumulation-Related Gene Expression and/or Enzyme Activity Analysis Combined With Metabolomics Provide a Novel Insight for an Orange Mutant. Scientific reports. 2016; 6:29343. |
|