CgSNP02, CgSNP02 (genetic_marker) Citrus grandis

Marker Overview
NameCgSNP02
dbSNP IDN/A
TypeSNP
SNP AllelesN/A
SpeciesCitrus grandis
Primer 1CgSNP02.Forward Primer: CAATAGTCAATGCAGAGGAGC
Primer 2CgSNP02.Reverse Primer: AAGACTGGAGGGCAACGC
Product Length518
Publication[view all]
ContactLijun Chai
Contact
NameDetails
Lijun Chai
First name:Lijun
Last name:Chai
Title:Researcher
Institution:Huazhong Agricultural University
Address:Key Laboratory of Horticultural Plant Biology, Ministry of Education, Key Laboratory of Horticultural Crop Biology and Genetic improvement (Central Region), MOA, Huazhong Agricultural University, Wuhan, Hubei, 430070, China
Country:China
Email:chailijun@mail.hzau.edu.cn
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerCgSNP02.Forward PrimerCitrus grandisprimer
Reverse PrimerCgSNP02.Reverse PrimerCitrus grandisprimer