CgSSR0017-4, CgSSR0017-4 (genetic_marker) Citrus grandis

Marker Overview
Genbank IDN/A
SpeciesCitrus grandis
Repeat MotifTCA(3*5)
Primer 1CgSSR0017-4.Forward Primer: CGGCAAATTAAGGAAGTATGAT
Product Length160
Publication[view all]
ContactLijun Chai
Lijun Chai
First name:Lijun
Last name:Chai
Institution:Huazhong Agricultural University
Address:Key Laboratory of Horticultural Plant Biology, Ministry of Education, Key Laboratory of Horticultural Crop Biology and Genetic improvement (Central Region), MOA, Huazhong Agricultural University, Wuhan, Hubei, 430070, China

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerCgSSR0017-4.Forward PrimerCitrus grandisprimer
Reverse PrimerCgSSR0017-4.Reverse PrimerCitrus grandisprimer