CgSSR0155-1, CgSSR0155-1 (genetic_marker) Citrus grandis

Marker Overview
NameCgSSR0155-1
Genbank IDN/A
TypeSSR
SpeciesCitrus grandis
Repeat MotifT(1*13)
Primer 1CgSSR0155-1.Forward Primer: AAGATAAAGAACCAGAACCGCTC
Primer 2CgSSR0155-1.Reverse Primer: CCAAATCCAGATATAGCACAAGC
Product Length97
Publication[view all]
ContactLijun Chai
Contact
NameDetails
Lijun Chai
First name:Lijun
Last name:Chai
Title:Researcher
Institution:Huazhong Agricultural University
Address:Key Laboratory of Horticultural Plant Biology, Ministry of Education, Key Laboratory of Horticultural Crop Biology and Genetic improvement (Central Region), MOA, Huazhong Agricultural University, Wuhan, Hubei, 430070, China
Country:China
Email:chailijun@mail.hzau.edu.cn
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerCgSSR0155-1.Forward PrimerCitrus grandisprimer
Reverse PrimerCgSSR0155-1.Reverse PrimerCitrus grandisprimer