CgSSR0987-5, CgSSR0987-5 (genetic_marker) Citrus grandis | Citrus Genome Database

Marker Overview

Marker Overview


Name	CgSSR0987-5
Genbank ID	N/A
Type	SSR
Species	Citrus grandis
Repeat Motif	TCA(3*5)
Primer 1	CgSSR0987-5.Forward Primer: CGTCTCTCTTTTTCGGAAATGTT
Primer 2	CgSSR0987-5.Reverse Primer: ATCGAGAGTCCATTTTTGGAGAT
Product Length	149
Publication	[view all]
Contact	Lijun Chai

Contact

Name

Details

Lijun Chai

First name:	Lijun
Last name:	Chai
Title:	Researcher
Institution:	Huazhong Agricultural University
Address:	Key Laboratory of Horticultural Plant Biology, Ministry of Education, Key Laboratory of Horticultural Crop Biology and Genetic improvement (Central Region), MOA, Huazhong Agricultural University, Wuhan, Hubei, 430070, China
Country:	China
Email:	chailijun@mail.hzau.edu.cn

Publications


Year	Publication
2015	Liang M, Yang X, Li H, Su S, Yi H, Chai L, Deng X. De novo transcriptome assembly of pummelo and molecular marker development. PloS one. 2015; 10(3):e0120615.