CMS4, CMS4 (genetic_marker) Citrus spp.

Marker Overview
NameCMS4
Genbank IDN/A
TypeSCAR
SpeciesCitrus spp.
Primer 1CMS4.Forward: CCTCAAACCTTCTTCCAATCC
Primer 2CMS4.Reverse: CTGTAAAGTACATGCATGTTGG
Publication[view all]
ContactMJ Asins
Qi-bin Hong
Contact
NameDetails
MJ Asins
First name:MJ
Last name:Asins
Title:Researcher
Institution:IVIA
Address:Instituto Valenciano de Investigaciones Agrarias (IVIA), Apartado Oficial, 46113 Moncada (Valencia), Spain
Country:Spain
Email:mjasins@ivia.es
Fax:+34-961390240
Qi-bin Hong
First name:Qi-Bin
Last name:Hong
Title:Researcher
Institution:Chinese Academy of Agricultural Sciences/Southwest University
Address:Citrus Research Institute, Chinese Academy of Agricultural Sciences/Southwest University, National Citrus Engineering Research Center, Chongqing, P.R. China
Country:China
Email:hongqb@sina.com
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
ForwardCMS4.ForwardCitrus spp.primer
ReverseCMS4.ReverseCitrus spp.primer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CMS4, 190CMS4, 190Citrus spp.marker_locus
CMS4CMS4Citrus spp.marker_locus
CMS4,190CMS4,190Citrus spp.marker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Poncirus-Rich/FlyingDragon-F1-2012Pr4aN/A20CMS4, 190View
2Citrus-Cleopatra/Trifoliatesp-F2-2012RPr4aN/A29CMS4, 190View
3Citrus-Li2/Wan2-F1-2015LG7N/A9.7CMS4View
4Citrus-Cleopatra/P.trifoliata-P.trifoliata-F1-2016p4aN/A23.29CMS4,190View